sacP [2018-07-26 14:01:46]

trigger enzyme: sucrose-specific phosphotransferase system, EIIBC component of the PTS

locus: BSU38050

pI: 7.03

mw: 49.29 kDa

protein length: 461 aa

gene length: 1383 bp

function: sucrose uptake and phosphorylation, control of SacT activity

product: trigger enzyme: sucrose-specific phosphotransferase system, EIIBC component

essential: no

ec: 2.7.1.69

synonyms: ipa-49d

Genomic Context

categories

• [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
• [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.19|Utilization of sucrose]
• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.4|Control of PRD-type regulators]
• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.1|Trigger enzymes of the PTS that control the activity of PRD-containing transcription factors]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
• [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]

Gene

Coordinates: 3,903,646 → 3,905,031

The protein

Catalyzed reaction/ biological activity

• Protein EIIB N(pi)-phospho-L-histidine/cysteine + sugar = protein EIIB + sugar phosphate (according to Swiss-Prot)

Protein family

• [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] permease, sucrose permease (Scr) family [Pubmed|10627040]

[SW|Localization]

• cell membrane (according to Swiss-Prot)

Expression and Regulation

Operons

• genes: [gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]-[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]-[gene|803ED978141A0E09F1F9CAECAB4BA839D480241F|ywdA]
  description: [Pubmed|3100393]

  sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8702561], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]

  regulatory mechanism

  • [protein|6796E1C147AA21E919A42A953884DC24E182F430|SacT]: antitermination, via binding to a [SW|RNA switch], in [regulon|6796E1C147AA21E919A42A953884DC24E182F430|SacT regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]

  regulation

  • induced by sucrose ([protein|search|SacT]) [Pubmed|2163394]

Biological materials

Mutant

• BKE38050 (Δ[gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTTCTCCCCCTTTT, downstream forward: _UP4_AATGAGGATGAGGAGAGGAA
• BKK38050 (Δ[gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTTCTCCCCCTTTT, downstream forward: _UP4_AATGAGGATGAGGAGAGGAA

Expression vector

• for expression, purification of the EIIB domain in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP429, available in [SW|Stülke] lab
• for expression, purification of the EIIB domain in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP436, available in [SW|Stülke] lab

References

• 10627040,12107147,3122206,2163394,8702561,2120236,22900538